Παρασκευή, 27 Μαΐου 2016

Πανελλήνια Ένωση Βιοεπιστημόνων ΠΕΒ: Προτεινόμενες Απαντήσεις Βιολογίας Θετικής Κατεύθυνσης 2016


ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ
Παρασκευή, 27 Μαΐου 2016
ΘΕΜΑ Α


1. β

2. β

3. δ

4. γ

5. γ

ΘΕΜΑ Β

Β1.

1. Α

2. Γ

3. Α

4. Β

5. Α

6. Α

7. Γ

Β2.

Η απάντηση βρίσκεται στην σελίδα 24 του σχολικού βιβλίου.

Καρυότυπος είναι η απεικόνιση των μεταφασικών χρωμοσωμάτων, ταξινομημένων σε ζεύγη κατά ελαττούμενο μέγεθος.

Συμπεράσματα που μπορούν να εξαχθούν από τη μελέτη του καρυοτύπου είναι το φύλο του ατόμου και αριθμητικές ή δομικές χρωμοσωμικές ανωμαλίες.

Β3.

α. Η απάντηση από την σελίδα 123 του σχολικού βιβλίου. “Τα

αντισώματα που παράγονται από έναν κλώνο Β-λεμφοκυπάρων και αναγνωρίζουν ένα αντιγονικό καθοριστή ονομάζονται μονοκλωνικά.”

β. Η απάντηση από την σελίδα 61 του σχολικού βιβλίου. “Οι τεχνικές με τις οποίες ο άνθρωπος επεμβαίνει στο γενετικό υλικό αποτελούν τη Γενετική Μηχανική.”

Β4.

Δεν προτιμούμε παραγωγή φαρμακευτικών πρωτεϊνών από βακτήρια διότι: Τα βακτήρια δεν διαθέτουν τους μηχανισμούς τροποποίησης πρωτεϊνών που διαθέτουν οι ευκαριωτικοί οργανισμοί, οπότε οι πρωτεΐνες που παράγονται δεν είναι ακριβώς ίδιες. Επίσης δεν διαθέτουν μηχανισμούς ωρίμανσης του mRNA.

Δεν προτιμούμε παραγωγή φαρμακευτικών πρωτεϊνών από όργανα θηλαστικών διότι: Η διαδικασία είναι δαπανηρή και πολύπλοκη, η παραγώμενη πρωτεΐνη μπορεί να προκαλέσει αλλεργικές αντιδράσεις και εξάγεται σε σχετικά μικρές ποσότητες.

Η απάντηση αναφέρεται στις σελίδες 64, 122 και 141 του σχολικού

βιβλίου.

ΘΕΜΑ Γ

Γ1.

Οι απόγονοι ΙΙ3 και ΙΙ4 έχουν γονότυπο ΙΑΙ

Β.

Η μητέρα Ι2 έχει τουλάχιστον ένα αλληλόμορφο γονίδιο Ι

Β . Από τους απόγονους ΙΙ3 και ΙΙ4 συνάγεται ότι ο πατέρας φέρει τουλάχιστον ένα αλληλόμορφο γονίδιο Ι

Α.

Σύμφωνα με τον πρώτο νόμο του Mendel τα παιδιά κληρονομούν ένα αλληλόμορφο γονίδιο από κάθε γονέα. Άρα, οι πιθανοί γονότυποι του Ι1 είναι:

Ι

Α

Ι

Β

ή ΙΑ

i

Τα γονίδια ΙΑ ,Ι

Β είναι συνεπικρατή και επικρατή στο i.

Σχόλιο: Η ορθή διατυπωση είναι: “Να γράψετε στο τετραδιό σας τον πιθανό γονότυπο του ατόμου Ι1...”

Γ2.

Γενεαλογικό δέντρο 2 : Αιμορροφιλία Α

Γενεαλογικό δέντρο 3 : Αλφισμός

Γενεαλογικό δέντρο 4 : Οικογενής υπερχοληστερολαιμία

Γ3.

Η αιμορροφιλία κληρονομείται με φυλοσύνδετο υπολυπόμενο τρόπο. Αντιστοιχεί στο Γενεαλογικό Δένδρο 2.

Στο Γενεαλογικό Δένδρο 2 το άτομο ΙΙ4 είναι ασθενές και ομόζυγο στο υπολειπόμενο γονίδιο (ΧαΧ

α

). Ο Ι1 είναι ασθενής (ΧαΥ), δηλαδή φέρει το υπολυπόμενο αλληλόμομρφο και η Ι2 είναι υγιής και
ετερόζυγη (ΧΑΧ

α

).

Η διασταύρωση ειναι:

Α: φυσιολογικό

α: αιμορροφιλικό

Ι1 Ι2

P: Χ

αΥ x Χ

ΑΧ

α

γαμέτες: Χα

, Υ ΧΑ

, Χα

F1: Χ

ΑΧ

α

, ΧαΧ

α

, ΧΑΥ , ΧαΥ

ΙΙ1 ΙΙ4 ΙΙ3 ΙΙ2

Ο αλφισμός κληρονομείται με αυτοσωμικό υπολυπόμενο τρόπο. Αντιστοιχεί με το Γενεαλογικό Δένδρο 3, καθώς και οι δύο γονείς είναι υγιείς και ετερόζυγοι για το υπολυπόμενο γονίδιο, οπότε είναι δυνατόν να αποκτήσουν και υγιείς και ασθενείς απογόνους.

Στο Γενεαλογικό Δένδρο 3

Α: φυσιολογικό

α: αλφικό

Ι1 Ι2

P: Αα x Αα

γαμέτες: Α,α Α,α

F: ΑΑ , Αα , Αα , αα

ΙΙ1 ΙΙ3 ΙΙ4 ΙΙ2

Η οικογενής υπερχοληστερολαιμία κληρονομείται με αυτοσωμικό επικρατή τρόπο. Αντιστοιχεί στο Γενεαλογικό Δένδρο 4. Τα άτομα Ι1, Ι2 είναι ασθενείς και ετερόζυγοι και μπορούν να αποκτήσουν τόσο ασθενείς όσο και υγιείς απογόνους.

Α: οικογενής υπερχοληστερολαιμία

α: φυσιολογικό

Ι1 Ι2

P: Αα x Αα

γαμέτες: Α,α Α,α

F: ΑΑ , Αα , Αα , αα

ΙΙ2 ΙΙ4 ΙΙ1 ΙΙ3

Γ4.

Σωστή απάντηση η Β.

Γνωρίζουμε πως η αντιγραφή του DNA γίνεται με ημισυντηρητικό τρόπο. Κάθε νέο δίκλωνο μόριο αποτελείται από μια παλαιά και μία καινούργια αλυσίδα. Κάθε νεοσυντιθέμενος κλώνος θα δημιουργηθεί με νουκλεοτίδια που φέρουν ραδιενεργό 32 Ρ. Στο τέλος των πέντε διαιρέσεων όλες οι νέες αλυσίδες περιέχουν νουκλεοτίδια με ραδιενεργό 32 Ρ, ενώ θα διατηρούνται οι δύο μητρικές που περιέχουν 2 x 105

ζ.β. Άρα 4 x 105 νουκλεοτίδια.

Σχόλιο: Το ερώτημα Γ4 επικεντρώνεται κυρίως στη μετατροπή των ζευγών βάσεων σε αριθμό νουκλεοτιδίων εις βάρος του ουσιαστικού περιεχομένου του θέματος που είναι ο ημισυντηρητικός τρόπος αντιγραφής.

Γ5.

Η αδυναμία διάσπασης της λακτόζης οφείλεται σε μεταλλάξεις που αναστέλλουν τη μεταγραφή και δεν συμβαίνουν στα δομικά γονίδια.

α) Μετάλλαξη στο ρυθμιστικό γονίδιο με αποτέλεσμα την αλλαγή του καταστολέα έτσι ώστε να μην μπορεί να συνδεθεί με τη λακτόζη, οπότε δεν απελευθερώνεται ο χειριστής και δεν μεταγράφονται τα δομικά γονίδια ούτε παράγονται τα αναγκαία ένζυμα.

β) Αν συμβεί μετάλλαξη στον υποκινητή του οπερονίου με αποτέλεσμα να είναι αδύνατη η πρόσδεση της RNA πολυμεράσης, οπότε δεν εκκινεί η μεταγραφή του οπερονίου.

ΘΕΜΑ Δ



Η παραπάνω αλληλουχία θα περιέχεται στο πρόδρομο mRNA που παράγεται ως συπληρωματικό και αντιπαράλληλο της μη κωδικής (μεταγραφόμενης) αλυσίδας του γονιδίου. Αυτή είναι η αλυσίδα Β.
Επομένως κωδική αλυσίδα είναι η συμπληρωματική και αντιπαράλληλη της Β, δηλαδή η αλυσίδα Α. Η μεταγραφή γίνεται με κατεύθυνση 5' – 3' , ξεκινώντας από το άκρο 3' της μη κωδικής αλυσίδας. Κωδική αλυσίδα Α: στο σημείο Ι φέρει το άκρο 5' και στο σημείο ΙΙ το άκρο 3'.
Μη κωδική αλυσίδα Β: στο σημείο ΙΙΙ φέρει το άκρο 3' και στο σημείο ΙΙΙΙ το άκρο 5'.
Κάθε αντικωδικόνιο του tRNA συνδέεται συμπληρωματκικά και αντιπαράλληλα με κωδικόνιο του mRNA. Τα δωθέντα αντικωδικόνια αντιστοιχούν σε :


5'[ACAGU...]AUG- UGG- UUU- CCU- AUG- UGG -GUU-UAA-GCA 3'
Δ2.

5'

- AATCATA - 3'

3' - TTAGTAT - 5'

Δ3.

Πρόδρομο mRNA:

5' [ACAGU...]AUGUGAAUCAUAGUUUCCUAUGUGGGUUUAAGCAU 3'

εσώνιο

Ώριμο mRNA:

5'[ACAGU...]AUG- UGG- UUU- CCU- AUG- UGG -GUU-UAA-GCA 3'

αντικωδικόνια 3'UAC5'3'ACC5'3'AAA5'3'GGA5'3'UAC5'3'ACC5'3'CAA5'

-

Δ4.

Μεταγραφόμενη είναι η αλυσίδα Γ με προσανατολισμό 5' ACAGT3'

.

Από τη μεταγραφή της προκύπτει rRNA συμπληρωματικό και αντιπαράλληλο με την αλληλουχία 5'ACAGU3' της 5' αμετάφραστης περιοχής του mRNAπου παράχθηκε από το γονίδιο της εικόνας 2.
Κατά τη μετάφραση το mRNAπροσδένεται μέσω μιας αλληλουχίας στην 5' αμετάφραστη περιοχή του, με το rRNΑ της μικρής υπομονάδας του ριβοσώματος σύμφωνα με τον κανόνα της
συμπληρωματικότητας των βάσεων.

Δ5.

Στη θέση 1: η προσθήκη γίνεται μέσα στο κωδικόνιο:

5' ΤΤΤ 3'

3' ΑΑΑ 5'

οπότε προκύπτει η αλλιλουχία:

5' ...TAGCTT... 3'

3' ...ATCGAA... 5'

η οποία περιέχει κωδικώνιο λήξης που πρόκαλει πρώορο τερματισμό της πρωτεϊνοσύνθεσης και πιθανή καταστροφή λειτουργικότητας της πρωτεΐνης.

Στη θέση 2: η προσθήκη γίνεται ανάμεσα σε δύο διαδοχικά κωδικόνια, οπότε προκύπτει:

5' ...CCTAGCATG... 3'

3' ...GGATCGTAC... 5'

με αποτέλεσμα ένα επιπλέον αμινοξύ στην πολυπεπτιδική αλυσίδα που μπορεί να οδηγεί σε αλλαγή της στερεοδιάταξης και της λειτουργικότητας της πρωτεΐνης.

Παρατήρηση:

Η προσθήκη μπορεί να συμβεί και στις δύο θέσεις με αντίστροφο προσανατολισμό.

Θέση 1: 5' ...TGCΤTT... 3'

3' ...ACGΑAA... 5'

οπότε προκύπτει πεπτιδική αλυσίδα στην οποία έχει προστεθεί ένα αμινοξύ, που μπορεί να αλάζει τη στερεοδιάταξη και τη λειτουργικότητα της πρωτεΐνης.

Θέση 2: 5' ...CCTGCΤATG... 3'

3' ...GGACGΑTAC... 5'

οπότε προκύπτει πεπτιδική αλυσίδα στην οποία έχει προστεθεί ένα αμινοξύ, που μπορεί να αλλάζει τη στερεοδιάταξη και τη λειτουργικότητα της πρωτεΐνης.

Ευχόμαστε καλή επιτυχία για τη συνέχεια


Η ΕΠΙΤΡΟΠΗ ΠΑΙΔΕΙΑΣ ΤΗΣ Π.Ε.Β. (ΠΑΝΕΛΛΗΝΙΑ ΕΝΩΣΗ ΒΙΟΕΠΙΣΤΗΜΟΝΩΝ)